Enter the position


Example input
More Parameters

Examples:

Type Chromosome Start position Editing pattern
Substitution chr1 943995 /T
Insertion chr1 943995 +GTATT
Deletion chr1 943995 -GAGAACTCGG

Above examples represent the input formats of three different editing types. The user should enter chromosome, starting position, and the editing pattern.

In these examples, the 943995th base in chr1 is base 'C', and the next 20 consecutive bases are 'GAGAACTCGGCACAGGAGAG').

  • The editing pattern begins with '/' ,'+' or '-' ,followed by the specific base sequence.
  • Substitution is indicated by backslash "/", and the example is used to replace C with T.
  • Insertion is indicated by plus sign "+", and the example indicates that GTATT will be inserted at the parenthesis position
  • Deletion is indicated by minus sign "-", and the example indicates that GAGAACTCGG will be deleted at the parenthesis position.
  • PAM Maximum Edit-to-Nick Distance
    Maximum PBS Length Maximum RTT Length
    Minimum PBS Length Minimum RTT Length
    Number of Optimized pegRNAS Assembly
    Minimum Nick-to-Nick Distance Maximum Nick-to-Nick Distance
    Minimum Downstream Homology
    Use an example: Substitution Insertion Deletion
    Chromosome
    Start position
    Editing pattern