Enter the sequence


Example input
More Parameters

Example for substitution:

CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC

Example for insertion:

CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC

Example for deletion:

CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGC(-GCTGGCGCGA)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC

Above three examples above represent the input formats of three different editing types.

  • The bases to be edited are marked with a pair of parentheses "()".

  • Substitution is indicated by backslash "/", and the example is used to replace A by T.

  • Insertion is indicated by plus sign "+", and the example indicates that ATT will be inserted at the parenthesis position

  • Deletion is indicated by minus sign "-", and the example indicates that GCTGGCGCGA will be deleted at the parenthesis position.

    • PAM Maximum Edit-to-Nick Distance
    Maximum PBS Length Maximum RTT Length
    Minimum PBS Length Minimum RTT Length
    Number of Optimized pegRNAs Assembly
    Minimum Nick-to-Nick Distance Maximum Nick-to-Nick Distance
    Minimum Downstream Homology

    Use an example: Substitution Insertion Deletion
    Example for FASTA file History